Annealing Temperature Calculator

The polymerase chain reaction, or PCR is nothing short of a miracle in the field of biotechnologies: learn how to optimize this beautiful technique with our PCR annealing temperature calculator!

Here you will learn everything you need to know about PCR, the materials needed, and the process itself. We will answer the following questions:

• What is the annealing in PCR?
• How do I find the annealing temperature for the best results?
• How do I use our primer annealing temperature calculator? (don't worry, it's extremely simple!)

Keep reading to learn more!

The polymerase chain reaction is an unexpected gift from biology. It's a laboratory technique that allows multiplying a small strand of DNA into an enormous amount of identical copies only by providing the right tools to an enzyme and the DNA's building blocks.

The process uses the natural mechanism of DNA replication (evolved over millions and billions of years) to its advantage: harnessed and carefully controlled, this allows us to target a single specific fragment of genetic code and greatly amplify its signal when analyzed.

To understand how PCR works, we need to discover DNA first!

🧬 DNA — deoxyribonucleic acid — is the manual of life on Earth. It's a simple molecule that contains the instructions to build a perfectly functional organism, from bacteria 🦠 to raccoons 🦝. Its structure is the famous double helix, where two strands of a biopolymer link and twist. The structure is similar to the single helix, one of the other nucleic acids fundamental to life, the RNA (ribonucleic acid).

You can picture a DNA molecule as a twisted ladder. Each step is made of a pair of molecules called nucleotides, each one in turn composed of a nucleoside and a phosphate. The steps are linked through the latter one. There is more: each nucleoside contains a nitrogenous base and a five-carbon sugar. Before the next step, let's check it out again:

• DNA = sequence of paired nucleotides;
• Nucleotide = nucleoside + phosphate; and
• Nucleoside = nitrogenous base + five-carbon sugar.

The pairing in each step happens at the connection between the bases. There are four types of bases, which pair in the following couples:

• Adenine, A + T, Thymine; and
• Guanine, G + C, Cytosine.

To be used, each strand of DNA must be "read" in the correct direction. Taking a look at the structure of a nucleotide, biologists decided to create a notation to aid in understanding which direction we are looking at every moment.

The enumeration of the five-carbon sugar makes it possible to identify two carbon atoms (one per nucleotide) connecting the phosphate groups in a DNA strand. Take a look at the image below:

The two carbons are named 3' and 5', and it is then possible to define a direction like $3'\rightarrow5'$, or its opposite, $5'\rightarrow3'$.

Now that you know how DNA is structured, let's learn how it replicates.

The cells in your body and every cell on this planet (apart from some exceptions) constantly follow a reproduction cycle (we have a tool to help you with counting them — the cell doubling time calculator). The process involves a copy of the genetic code (the DNA) to create two cells with a complete set of genes, the instructions needed to "build" an individual. The process itself is complicated, to say the least: we will be able to explain it only briefly to introduce the actors of the PCR.

At the beginning of the replication process, the DNA double helix is "flattened" and split into two single-strands (ssDNA). Each strand exposes its bases, allowing a complex group of enzymes to recreate the complementary strands.

The first thing that happens once the double helix opens is the priming of the strand: the enzymes have some limitations and can't start "copying" directly on DNA. A short segment of RNA called a primer (complementary to a specific sequence of bases) is attached to the target strand. From there, an enzyme called DNA polymerase starts attaching new nucleotides, pairing them to the strand's ones, and connecting them via the phosphate bridge.

The DNA polymerase works exclusively in the $5'\rightarrow3'$ direction, and therefore it can operate directly on one strand of the separated double helix only (it starts the replication from the opening point on both ssDNA). The copy on the "wrong" strand proceeds in small batches, joined afterward.

Many other processes happen; we've described only the fundamentals. The replication goes on, with the DNA's double helix progressively open until it unravels entirely, and we obtain two daughter filaments, both of them carrying half of the parent molecule.

PCR, the polymerase chain reaction, is the most ground-breaking simple technique in biology. It takes a short sample of DNA and exponentially replicates it millions of times with the help of the polymerase enzyme. The entire process is driven by a thermal cycle, making it extremely simple and convenient to perform.

The principle of PCR is to reproduce the replication process of DNA in a vial, specifically on the target fragment, and to allow this process to repeat multiple times. From a single strand, you would get two daughters, from two, four, and so on — the only limit is set by the available quantity of reagents.

This process allows making small fragments impossible to find in a genetic code by search (it would be even worse than looking for the proverbial needle in the haystack) but easily detectable after their exponential amplification. This technique became the best tool in the shed of every scientist working with scarce DNA: archeologists and paleontologists, forensic chemists, and geneticists. Everyone got their slice of cake!

PCR requires a surprisingly small amount of "ingredients" to be carried out successfully. Let's take a look at them.

• The target fragment, or DNA template, is the specific portion of the genetic code that will undergo amplification.

• The DNA primers are short single-strand fragments, usually given in two types that correspond to the target's specific side of each end (the $3'$). Only when the genetic sequence of the target is known can they be synthesized.

• The polymerase enzyme, the real star of the process. It allows amplification by attaching new nucleotides to the parent strands. Currently, laboratories use a heat-resistant enzyme called Taq-polymerase.

• The nucleotides needed to create the copies. They are in the form of deoxynucleotide triphosphates: the two "excess" phosphate groups provide energy to the enzyme.

• The buffer solution, the environment where the reaction takes place, stabilized by divalent cations like $\text{Mg}^{2+}$.

Now that we know the ingredients let's go to the recipe — this is almost a biochemist's food blog!

A temperature cycle drives PCR since each of its steps (chemical reactions) happen at very strict and distinct temperature ranges. It is possible to "activate" and "deactivate" a step by heating or cooling the solution where PCR is happening. This mechanism allowed for the easy automation of PCR in thermal cyclers.

Let's look at the steps of the process in detail. First, pour all of your ingredients into the vial. Turn on your thermal cycler, and let the biology happen!

1. Denaturation. In this step, the temperature is raised to 94-98 °C for 20-30 seconds. The target DNA separates into two single strands as the hydrogen bonds between bases break.

2. Annealing. The temperature is lowered to 50-65 °C for another 20-40 seconds. The primers anneal (attach to) the target DNA in this phase. The temperature of this step is crucial since only the correct value allows for a perfect match between target and primer - which otherwise may join the wrong sequence.

3. Elongation phase. During this step, the temperature is raised to 75-80 °C, precisely at the optimum temperature for the polymerase enzyme. The free nucleotides are paired with the target DNA, effectively creating a new copy of the original fragment. The duration depends on the length of the target and the chosen enzyme.

Once we reach the third step, we start again with the first one, thus opening all of the copied target fragments and having four of the ssDNA available.

When the nucleotides are depleted, the process ends by itself. According to the number of "fully" performed cycles $n$ (where there still was an excess of bases), it is possible to estimate the number of fragments $N_\text{DNA}$ now present in the solution. The formula is so simple it looks wrong:

So, if the thermal cycler performs ten cycles, we end up with $2^{10}=1,\!024$ fragments. But another ten cycles (thus twenty in total) would bring the number of copies to $2^{20}=1,\!048,\!756$. The increment is purely exponential, and since it all begins from a single fragment, it is a pure chain reaction: learn the math behind the biology at our exponential growth calculator!

In the next section, we will learn how to find the primer annealing temperature in PCR!

The PCR annealing temperature is the temperature of the annealing step in a PCR thermal cycle. Its value depends on the denaturation temperatures of both the (less stable) primer and the target DNA.

The empirical formula used to determine the optimal annealing temperature $T_{\text{a}}^*$ is:

Here, $T_{\text{m}}^{\text{p}}$ is the denaturation (melting) temperature of the most unstable primer, and $T_{\text{m}}^{\text{t}}$ the melting temperature for the target.

Their values are determined with other formulas, depending on the composition and length of the filaments.

The annealing temperature controls how the primer fragments join the target strands. A higher temperature means that the bonds between the primer and the target may not form at all. On the other hand, lower temperatures allow for bonding on the incorrect sequence of bases.

After the primer and target bond, the polymerase enzyme joins the party, connecting to the $3'$ extremity of the primer, and waits for the temperature to be optimal for elongation.

We will quickly teach you how to use our optimal primer annealing temperature calculator!

Let's go for an example. We chose a strand of DNA from a cat gene from an online repository. The target strand we looked for is $\thicksim 2\ \text{kb}$, where $\text{kb}$ means kilobases, or a thousand nucleotides. We are NOT going to write it here!

We set up the right experimental conditions (the concentrations of ions and other reagents), and using the formula by Wallace we obtained a melting temperature $T_\text{m}^\text{t}=88.6\ \degree\textrm{C}$.

Now we need to design the primers. It's an art by itself: for this example, we simply copied the last 30 bases on both terminations of the target DNA. Using the formula by Allawi and SantaLucia, we determined the melting temperature for the primers. Here are the two filaments:

• GGGGGATCTTTCTCTATAGGAAACAATTAA with $T_\text{m}^{\text{p}_1}=65.5\ \degree\textrm{C}$; and

• CACAAGCACACATGCGCACATTTGCACACA with $T_\text{m}^{\text{p}_2}=74.6\ \degree\textrm{C}$.

From here on, you can help us! Take the melting temperature of the target and the melting temperature of the less stable primer, and plug them into the calculator. The result comes from the formula:

This temperature is slightly above the suggested range for annealing (60–65 °C), but we weren't designing a real experiment, so it's still good!

You learned everything from DNA structure (but we guess you already knew something!) to how to find the annealing temperature in a PCR cycle. We hope our primer annealing temperature calculator helped you design your experiment or just satisfied your curiosity.

Try other biology 👩‍⚕️ calculators like the ligation calculator or the trihybrid cross calculator!